% -*- mode: noweb; noweb-default-code-mode: R-mode; -*-
\documentclass[11pt]{article}
%% Set my margins
\setlength{\oddsidemargin}{0.0truein}
\setlength{\evensidemargin}{0.0truein}
\setlength{\textwidth}{6.5truein}
\setlength{\topmargin}{0.0truein}
\setlength{\textheight}{9.0truein}
\setlength{\headsep}{0.0truein}
\setlength{\headheight}{0.0truein}
\setlength{\topskip}{0pt}
%% End of margins

\usepackage{subfigure}

%%\pagestyle{myheadings}
%%\markboth{$Date$\hfil$Revision$}{\thepage}
\usepackage[pdftex,
bookmarks, 
bookmarksopen,
pdfauthor={Dongjun Chung, Pei Fen Kuan, Rene Welch, and Sunduz Keles},
pdftitle={mosaics Vignette}]
{hyperref}

\title{Analysis of ChIP-seq Data with `\texttt{mosaics}' Package:\\
MOSAiCS and MOSAiCS-HMM}
\author{Dongjun Chung$^1$, Pei Fen Kuan$^2$, Rene Welch$^3$, and S\"und\"uz Kele\c{s}$^{3,4}$\\
  $^1$Department of Public Health Sciences, Medical University of South Carolina\\ 
  Charleston, SC 29425.\\
  $^2$Department of Applied Mathematics and Statistics, Stony Brook University\\
  Stony Brook, NY 11794.\\
  $^3$Department of Statistics, University of Wisconsin\\ 
  Madison, WI 53706.\\
  $^4$Department of Biostatistics and Medical Informatics, University of Wisconsin\\
  Madison, WI 53706.}

\date{\today}

\SweaveOpts{engine=R, echo=TRUE, pdf=TRUE}

\begin{document}
%\VignetteIndexEntry{MOSAiCS}
%\VignetteKeywords{MOSAiCS}
%\VignettePackage{mosaics}
\maketitle

\tableofcontents

\section{Overview}

This vignette provides an introduction to the analysis of ChIP-seq data with
the `\texttt{mosaics}' package. R package \texttt{mosaics} implements MOSAiCS,
a statistical framework for the analysis of ChIP-seq data, proposed 
in \cite{mosaics}. MOSAiCS stands for ``\textbf{MO}del-based one and
two \textbf{S}ample \textbf{A}nalysis and \textbf{I}nference for
\textbf{C}hIP-\textbf{S}eq Data''. It implements a flexible parametric mixture
modeling approach for detecting peaks, i.e., enriched regions, in one-sample
(ChIP sample) or two-sample (ChIP and matched control samples) ChIP-seq data.
It can account for mappability and GC content biases that arise in ChIP-seq data.

Recently, we extended the MOSAiCS framework with a hidden Markov Model (HMM) architecture,
named MOSAiCS-HMM \cite{mosaicsHMM}, to identify broad peaks.
By considering the HMM architecture, MOSAiCS-HMM allows modeling of read counts
in histone modifiation ChIP-seq experiments and
accounts for the spatial dependence in their ChIP-seq profiles.

The package can be loaded with the command:

<<preliminaries,echo=FALSE,results=hide>>=
options(prompt = "R> ")
@

<<mosaics-prelim>>=
library("mosaics")
@

\noindent
`\texttt{mosaicsExample}' package is a companion package for the `\texttt{mosaics}' package
and it provides various example ChIP-seq datasets for MOSAiCS and MOAiCS-HMM, as illustrated in this vignette.

<<mosaicsExample-prelim>>=
library("mosaicsExample")
@

In this vignette, we focus on chromosome 22 data from ChIP-seq experiments of STAT1 binding
and H3K4me3 modification in GM12878 cell line, downloaded from the ENCODE database
(\url{http://genome.ucsc.edu/ENCODE/}).
In Section \ref{two_sample_MGC}, we consider chromosome 21 data from a ChIP-seq
experiment of STAT1 binding in interferon-$\gamma$-stimulated HeLa S3 cells \cite{stat1}. 

\section{Getting started}

`\texttt{mosaics}' package provides flexible framework for the ChIP-seq analysis.
If you have the data for matched control sample, 
two-sample analysis is recommended.
If the ChIP-seq data is deeply sequenced, 
the two-sample analysis without mappability and GC content
(Section \ref{two_sample_no_MGC}) is usually appropriate.
For the ChIP-seq data with low sequencing depth,
the two-sample analysis with mappability and GC content 
(Section \ref{two_sample_MGC}) can be useful.
When control sample is not available, `\texttt{mosaics}' package accommodates
one-sample analysis of ChIP-seq data. 
In this case, you should have files for mappability and GC content, 
in addition to the files for ChIP and matched control samples.

Section \ref{two_sample_no_MGC} discusses each step of the two-sample workflow
and provides command lines for each step.
Section \ref{analysis_mosaicshmm} discusses steps of analyzing histone modification
ChIP-seq experiments using MOSAiCS-HMM.
Section \ref{postprocessing} discusses steps of post-processing peak call results,
including identifying peak summits, adjusting peak boundaries, and filtering potentionally false positive peaks.
Section \ref{mosaicsRunAll} discusses the most convenient way to do the two-sample analysis
(without using mappability and GC content) by running a single function.
Sections \ref{two_sample_MGC} and \ref{one_sample} briefly explain
the workflow and command lines for the two-sample analysis and the one-sample analysis
with mappability and GC content, respectively.

We encourage  questions or requests regarding 
`\texttt{mosaics}' package to be posted on our Google group
\url{http://groups.google.com/group/mosaics_user_group}.

\section{Identification of Punctuated Peaks using MOSAiCS}\label{two_sample_no_MGC}

\subsection{Constructing Bin-Level Files from the Aligned Read File}\label{constructBins}

R package `\texttt{mosaics}' analyzes the data after converting aligned read files 
into bin-level files for modeling and visualization purposes.
Bin-level data for ChIP and control samples can easily be generated from the aligned read files with the command: 

<<constructBins,eval=TRUE>>=
constructBins( infile=system.file( file.path("extdata","wgEncodeSydhTfbsGm12878Stat1StdAlnRep1_chr22_sorted.bam"), package="mosaicsExample"), 
    fileFormat="bam", outfileLoc="./", 
    byChr=FALSE, useChrfile=FALSE, chrfile=NULL, excludeChr=NULL, 
    PET=FALSE, fragLen=200, binSize=200, capping=0 )
constructBins( infile=system.file( file.path("extdata","wgEncodeSydhTfbsGm12878InputStdAlnRep1_chr22_sorted.bam"), package="mosaicsExample"), 
    fileFormat="bam", outfileLoc="./", 
    byChr=FALSE, useChrfile=FALSE, chrfile=NULL, excludeChr=NULL, 
    PET=FALSE, fragLen=200, binSize=200, capping=0 )
@

You can specify the name and file format of the aligned read file 
in `\texttt{infile}' and `\texttt{fileFormat}' arguments, respectively.
The `\texttt{PET}' argument indicates whether the file is paired-end tag (`\texttt{PET=TRUE}') or single-end tag (`\texttt{PET=FALSE}') ChIP-Seq data.
Allowed aligned read file formats depend on the `\texttt{PET}' argument.
`\texttt{constructBins}' method currently allows the following aligned read file formats for SET ChIP-Seq data:
BAM (`\texttt{"bam"}'), SAM (`\texttt{"sam"}'), BED (`\texttt{"bed"}'), 
Eland result (`\texttt{"eland}$\_$\texttt{result"}'), Eland extended (`\texttt{"eland}$\_$\texttt{extended"}'),
Eland export (`\texttt{"eland}$\_$\texttt{export"}'), default Bowtie (`\texttt{"bowtie"}'), and CSEM BED (`\texttt{"csem"}').
%This method assumes that these aligned read files are obtained from single-end tag (SET) experiments.
For PET ChIP-Seq data, `\texttt{constructBins}' method currently accepts the
BAM (`\texttt{"bam"}'), SAM (`\texttt{"sam"}'), and Eland result (`\texttt{"eland}$\_$\texttt{result"}') file formats.
If input file format is neither BED nor CSEM BED,
it retains only reads mapping uniquely to the reference genome (uni-reads). 
See Appendices \ref{example_aligned_SET} and \ref{example_aligned_PET} for example lines of each aligned read file format.

Even though `\texttt{constructBins}' retains only uni-reads for most aligned read file formats,
reads mapping to multiple locations on the reference genome (multi-reads)
can be easily incorporated into bin-level files by utilizing our multi-read allocator, 
\texttt{CSEM} (ChIP-Seq multi-read allocator using Expectation-Maximization algorithm).
Galaxy tool for CSEM is also available in Galaxy Tool Shed (\url{http://toolshed.g2.bx.psu.edu/}; ``csem'' under ``Next Gen Mappers'') and stand-alone version of CSEM is also available at \url{http://deweylab.biostat.wisc.edu/csem/}.
CSEM exports uni-reads and allocated multi-reads into standard BED file
and the corresponding bin-level files can be constructed 
by applying `\texttt{constructBins}' method to this BED file with the argument
`\texttt{fileFormat="csem"}'.

`\texttt{constructBins}' can generate a single bin-level file containing all chromosomes
(for a genome-wide analysis) or multiple bin-level files for each chromosome
(for a chromosome-wise analysis).
If `\texttt{byChr=FALSE}', bin-level data for all chromosomes are exported to one file
named as `\texttt{[infileName]}$\_$\texttt{fragL[fragLen]}$\_$\texttt{bin[binSize].txt}' (for SET data)
or `\texttt{[infileName]}$\_$\texttt{bin[binSize].txt}' (for PET data),
where \texttt{[infileName]}, \texttt{[fragLen]}, and \texttt{[binSize]} are
name of aligned read file, average fragment length, and bin size, respectively.
If `\texttt{byChr=TRUE}', bin-level data for each chromosome is exported
to a separate file named as `\texttt{[infileName]}$\_$\texttt{fragL[fragLen]}$\_$\texttt{bin[binSize]}$\_$\texttt{[chrID].txt}' (for SET data) or `\texttt{[infileName]}$\_$\texttt{bin[binSize]}$\_$\texttt{[chrID].txt}' (for PET data),
where \texttt{[chrID]} is chromosome ID that reads align to.
These chromosome IDs (\texttt{[chrID]}) are extracted from the aligned read file.
The constructed bin-level files are exported to the directory 
specified in `\texttt{outfileLoc}' argument.

The `\texttt{useChrfile}' argument indicates whether to use the file containing chromosome ID and chromosome size, which is specified in the `\texttt{chrfile}' argument.
See Appendix \ref{example_chrfile} for the example lines of this chromosome information file.
If you want to exclude some chromosomes in the processed bin-level files,
you can specify these chromosomes in `\texttt{excludeChr}' argument.
The `\texttt{excludeChr}' argument will be ignored if `\texttt{useChrfile=TRUE}'.

You can specify average fragment length and bin size in `\texttt{fragLen}' and `\texttt{binSize}' arguments, respectively,
and these arguments control the resolution of bin-level ChIP-seq data.
By default, average fragment length is set to 200 bp, which is the common fragment length
for Illumina sequences, and bin size equals to average fragment length.
The `\texttt{fragLen}' argument is ignored for PET ChIP-seq data (`\texttt{PET = TRUE}').
`\texttt{capping}' argument indicates maximum number of reads allowed to start at each nucleotide position.
Using some small value for capping (e.g., `\texttt{capping=3}') will exclude extremely large read counts that might correspond to PCR amplification artifacts, which is especially useful for the ChIP-seq data with low sequencing depth. 
Capping is not applied (default) if `\texttt{capping}' is set to some non-positive value, e.g., `\texttt{capping=0}'.

\subsection{Reading Bin-Level Data into the R Environment}\label{readBins}

You now have bin-level ChIP data and matched control sample data from '\texttt{constructBins}'.
Bin-level data can be imported to the R environment with the command:

<<io-readbin>>=
fileName <- c(
    "wgEncodeSydhTfbsGm12878Stat1StdAlnRep1_chr22_sorted.bam_fragL200_bin200.txt",
    "wgEncodeSydhTfbsGm12878InputStdAlnRep1_chr22_sorted.bam_fragL200_bin200.txt")

binTFBS <- readBins( type=c("chip","input"), fileName=fileName )
@

For the  `\texttt{type}' argument, 
\texttt{"chip"} and \texttt{"input"} indicate bin-level ChIP data
control sample data, respectively. You need to specify the corresponding file names 
in `\texttt{fileName}'. `\texttt{mosaics}' package assumes that each file name 
in `\texttt{fileName}' is provided in the same order as in `\texttt{type}'. 

In \texttt{mosaics} package, you can do either genome-wide analysis or chromosome-wise analysis
and this analysis type will be determined automatically 
based on the contents of bin-level files imported using `\texttt{readBins}'.
If the bin-level files contain more than one chromosome
(i.e., bin-level files are obtained using `\texttt{byChr=FALSE}' in `\texttt{constructBins}'), 
`\texttt{mosaicsFit}' will analyze all the chromosomes simultaneously (genome-wide analysis).
Note that if these bin-level files contain different sets of chromosomes,
then `\texttt{readBins}' method will utilize only the intersection of them.
If bin-level files are obtained using `\texttt{byChr=FALSE}' in `\texttt{constructBins}',
each bin-level file contains data for only one chromosome
and each of these bin-level files need to be analyzed separately (chromosome-wise analysis).
The genome-wide analysis usually provide more stable model fitting and peak identification results
so it is recommended for most cases.

R package \texttt{mosaics} provides functions for generating simple summaries
of the data. The following command prints out basic information about the
bin-level data, such as number of bins and total ``effective tag counts''.
``Total effective tag counts'' is defined as the sum of the ChIP tag counts of all
bins. This value is usually larger than the sequencing depth since tags are
counted after extension to average fragment length and an extended fragment can
contribute to multiple bins. 

<<io-bindata-show>>=
binTFBS
@

`\texttt{print}' method returns the bin-level data in data frame format.

<<io-bindata-print>>=
print(binTFBS)[ 90600:90614, ]
@

`\texttt{plot}' method provides exploratory plots for the ChIP data. Different
type of plots can be obtained by varying the `\texttt{plotType}' argument.
`\texttt{plotType="input"}' generates a plot of mean ChIP tag counts versus
control tag counts. If `\texttt{plotType}' is not specified, this method plots the
histogram of ChIP tag counts.

<<io-bindata-plot,eval=FALSE>>=
plot( binTFBS )
plot( binTFBS, plotType="input" )
@

Figures \ref{fig:bindata-plot-hist} and \ref{fig:bindata-plot-input} display
examples of different types of plots. The relationship
between mean ChIP tag counts and control tag counts seems to be linear,
especially for small  control tag counts (Figure \ref{fig:bindata-plot-input}).

\begin{figure}[tb]
\begin{center}
<<fig-bindata-plot-hist,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot(binTFBS)
@
\caption{\label{fig:bindata-plot-hist} Histograms of the  count data 
from ChIP and control samples.}
\end{center}
\end{figure}

\begin{figure}[tb]
\begin{center}
<<fig-bindata-plot-input,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot( binTFBS, plotType="input" )
@
\caption{\label{fig:bindata-plot-input} Mean ChIP tag count versus
Control tag count.}
\end{center}
\end{figure}

\subsection{Fitting the MOSAiCS Model}\label{mosaicsFit}

We are now ready to fit a MOSAiCS model using the bin-level data above
(\texttt{binTFBS}) with the command:

<<io-mosaicsfit>>=
fitTFBS <- mosaicsFit( binTFBS, analysisType="IO", bgEst="rMOM" )
@

`\texttt{analysisType="IO"}' indicates implementation of the two-sample analysis.
`\texttt{bgEst}' argument determines background estimation approach.
`\texttt{bgEst="matchLow"}' estimates background distribution using only bins with low tag counts
and it is appropriate for the data with relatively low sequencing depth. 
`\texttt{bgEst="rMOM"}' estimates background distribution using robust method of moment (MOM) (default) and
it is appropriate for the data with relatively high sequencing depth.
If `\texttt{bgEst="automatic"}', `\texttt{mosaicsFit}' tries its best guess 
for the background estimation approach, based on the data provided.
If the goodness of fit obtained using `\texttt{bgEst="automatic"}' is not satisfactory,
we recommend users to try `\texttt{bgEst="matchLow"}' and `\texttt{bgEst="rMOM"}' 
and it might improve the model fit.

`\texttt{mosaicsFit}' fits both one-signal-component and two-signal-component
models. When identifying peaks, you can choose the number of signal components
to be used for the final model. The optimal choice of the number of signal
components depends on the characteristics of data. In order to support users
in the choice of optimal signal model, \texttt{mosaics} package provides
Bayesian Information Criterion (BIC) values and Goodness of Fit (GOF) plots
of these signal models. 

The following command prints out BIC values of one-signal-component and
two-signal-component models, with additional information about the parameters
used in fitting the background (non-enriched) distribution. A lower BIC value
indicates a better model fit. In this dataset, BIC values are quite comparable
between one- and two-signal-component models although BIC value is slightly smaller
for one-signal-component model.

<<io-mosaicsfit-show>>=
fitTFBS
@

`\texttt{plot}' method provides the GOF plot.  This plots allows visual
comparisons of the fits of the background, one-signal-component, and
two-signal-component models with the actual data.  Figure
\ref{fig:mosaicsfit-plot} displays the GOF plot for our dataset and we 
conclude that the one- and two-signal-component models provide comparable model fit
as is also suggested by BIC values. 

<<io-mosaicsfit-plot,eval=FALSE>>=
plot(fitTFBS)
@

\begin{figure}[tb]
\begin{center}
<<fig-mosaicsfit-plot,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot(fitTFBS)
@
\caption{\label{fig:mosaicsfit-plot} Goodness of Fit (GOF) plot. Depicted are
actual data for ChIP and control samples with simulated data from the following
fitted models: (Sim:N): Background model; (Sim:N+S1): one-signal-component
model; (Sim:N+S1+S2): two-signal-component model. }
\end{center}
\end{figure}

\subsection{Identifying Peaks Based on the Fitted Model}\label{mosaicsPeak}

We can now identify peaks
with the two-signal-component model at a false discovery rate (FDR) of 0.05
with the command:

<<ts-mosaicspeak>>=
peakTFBS <- mosaicsPeak( fitTFBS, signalModel="2S", FDR=0.05, 
maxgap=200, minsize=50, thres=10 )
@

`\texttt{signalModel="2S"}' indicates two-signal-component model. Similarly,
one-signal-component model can be specified by `\texttt{signalModel="1S"}'. 
FDR can be controlled at the desired level by specifying `\texttt{FDR}' argument. 
In addition to these two essential parameters, you can also control three more
parameters, `\texttt{maxgap}', `\texttt{minsize}', and `\texttt{thres}'. These
parameters are for refining initial peaks called using specified signal model
and FDR.  Initial nearby peaks are merged if the distance (in bp) between them
is less than `\texttt{maxgap}'. Some initial peaks are removed if their lengths
are shorter than `\texttt{minsize}' or their ChIP tag counts are less 
than `\texttt{thres}'.

If you use a bin size shorter than the average fragment length in the
experiment, we recommend to set `\texttt{maxgap}'  to the  average fragment
length and `\texttt{minsize}'  to the bin size. This setting removes peaks 
that are too narrow (e.g., singletons). If you set the bin size to the average
fragment length (or maybe bin size is larger than the average fragment length),
we recommend  setting `\texttt{minsize}'  to a value  smaller than the average
fragment length while leaving `\texttt{maxgap}' the same as the average
fragment length. This is to prevent filtering using `\texttt{minsize}' because
initial peaks would already be at a reasonable width. `\texttt{thres}' is
employed to filter out initial peaks with very small ChIP tag counts because
such peaks might be false discoveries. Optimal choice of `\texttt{thres}'
depends on the sequencing depth of the ChIP-seq data to be analyzed. If you
don't wish to filter out initial peaks using ChIP tag counts, you can set
`\texttt{thres}'  to an arbitrary negative value.

The following command prints out a summary of identified peaks including 
the number of  peaks identified, median peak width, and the empirical false
discovery rate (FDR).

<<io-mosaicspeak-show>>=
peakTFBS
@

`\texttt{print}' method returns the peak calling results in data frame format.
This data frame can be used as an input for downstream analysis such as motif
finding. This output might have different number of columns, depending on
`\texttt{analysisType}' of `\texttt{mosaicsFit}'. For example, in the case of two-sample analysis
(`\texttt{analysisType="IO"}'), columns are chromosome ID, peak start position, peak end
position, peak width, averaged posterior probability, minimum posterior
probability, averaged ChIP tag count, maximum ChIP tag count, averaged control
tag count, averaged control tag count scaled by sequencing depth, and averaged log
base 2 ratio of ChIP over input tag counts for each peak. Here, the posterior probability of a
bin refers to  the probability that the bin belongs to background conditional on data.
Hence, smaller posterior probabilities provide more evidence that the bin is
actually a peak.

<<io-mosaicspeak-print>>=
head(print(peakTFBS))
@

You can export peak calling results to text files in diverse file formats.
Currently, `\texttt{mosaics}' package supports TXT, BED, GFF, narrowPeak, and broadPeak file formats.
In the case of TXT file format (`\texttt{type="txt"}'), all the
columns provided by `\texttt{print}' method are exported. `\texttt{type="bed"}' and
`\texttt{type="gff"}' export peak calling results in standard BED and GFF file
formats, respectively, where score is the averaged ChIP tag counts in each peak. 
narrowPeak and broadPeak are modified BED file formats
and these file formats are used by the ENCODE
Consortium and more information about these file formats can be found in
\url{http://genome.ucsc.edu/FAQ/FAQformat.html}.
In narrowPeak and broadPeak file formats, the 5th, 7th, and 8th columns are
averaged log base 2 ratio of ChIP over input tag counts
(or averaged ChIP tag counts, if the matched control sample is not provided), 
ChIP signal at peak summit, and -log10 transformed minimum posterior probability.
Note that narrowPeak and broadPeak file formats are supported 
only after `\texttt{extractReads}' and `\texttt{findSummit}'
methods are applied to `\texttt{MosaicsPeak}' object because it requires peak summit information.
See Section \ref{findSummit} for more information.

Peak calling results can be exported in TXT, BED, GFF, narrowPeak, and broadPeak file formats, 
respectively, by the following commands, were
`\texttt{fileLoc}' and `\texttt{fileName}' indicate the directory and the name
of the exported file:

<<io-mosaicspeak-export,eval=FALSE>>=
export( peakTFBS, type="txt", filename="peakTFBS.txt" )
export( peakTFBS, type="bed", filename="peakTFBS.bed" )
export( peakTFBS, type="gff", filename="peakTFBS.gff" )
export( peakTFBS, type="narrowPeak", filename="peakTFBS.narrowPeak" )
export( peakTFBS, type="broadPeak", filename="peakTFBS.broadPeak" )
@
         
\subsection{Generating Wiggle Files to View on Genome Browsers}\label{generateWig}

R package `\texttt{mosaics}' can generate wiggle files (\url{http://genome.ucsc.edu/goldenPath/help/wiggle.html}) for visualization purposes.
These wiggle files can be used as input for many genome browsers such as the UCSC genome browser (\url{http://genome.ucsc.edu/}) and IGV (\url{http://www.broadinstitute.org/igv/}). 
These wiggle files can easily be generated from the aligned read files with the command: 

<<generateWig,eval=TRUE>>=
generateWig( infile=system.file( file.path("extdata","wgEncodeSydhTfbsGm12878Stat1StdAlnRep1_chr22_sorted.bam"), package="mosaicsExample"), 
    fileFormat="bam", outfileLoc="./", 
    byChr=FALSE, useChrfile=FALSE, chrfile=NULL, excludeChr=NULL, 
    PET=FALSE, fragLen=200, span=200, capping=0, normConst=1 )
@

The `\texttt{generateWig}' function has similar arguments as the `\texttt{constructBins}' function,
except that it has `\texttt{span}' and `\texttt{normConst}' arguments 
instead of the `\texttt{binSize}' argument of the `\texttt{constructBins}' function.
The `\texttt{generateWig}' function supports the same set of aligned read file formats as in the `\texttt{constructBins}' function.
The `\texttt{span}' argument indicates span used in wiggle files.
The `\texttt{normConst}' argument means the normalizing constant to scale the values in wiggle files
and it is especially useful when wiggle files for multiple related samples are generated and compared.
In the resulting wiggle files, values are scaled by the value specified in the `\texttt{normConst}' argument.

`\texttt{generateWig}' can generate a single wiggle file containing all chromosomes or multiple wiggle files for each chromosome.
If `\texttt{byChr=FALSE}', all chromosomes are exported to one file
named as `\texttt{[infileName]}$\_$\texttt{fragL[fragLen]}$\_$\texttt{span[span].wig}' (for SET data)
or `\texttt{[infileName]}$\_$\texttt{span[span].wig}' (for PET data),
where \texttt{[infileName]}, \texttt{[fragLen]}, and \texttt{[span]} are
name of aligned read file, average fragment length, and span, respectively.
If `\texttt{byChr=TRUE}', each chromosome is exported to a separate file named as `\texttt{[infileName]}$\_$\texttt{fragL[fragLen]}$\_$\texttt{span[span]}$\_$\texttt{[chrID].wig}' (for SET data) or
`\texttt{[infileName]}$\_$\texttt{span[span]}$\_$\texttt{[chrID].wig}' (for PET data),
where \texttt{[chrID]} is chromosome ID that reads align to.
%These chromosome IDs (\texttt{[chrID]}) are extracted from the aligned read file.
The constructed wiggle files are exported to the directory 
specified in `\texttt{outfileLoc}' argument.

\section{Identification of Broad Peaks using MOSAiCS-HMM}\label{analysis_mosaicshmm}

In `\texttt{mosaics}' package, broad peaks can be identified with MOSAiCS-HMM model, using methods `\texttt{mosaicsFitHMM}' and `\texttt{mosaicsPeakHMM}'. In this section, we use ChIP-seq data of H3K4me3 for illustration. For computational efficiency, `\texttt{mosaicsFitHMM}' utilizes MOSAiCS model fit as estimates of emission distribution of MOSAiCS-HMM model. In addition, it also considers MOSAiCS peak calling results at specified FDR level (`\texttt{init.FDR}') as initial values by default. MOSAiCS model fit for H3K4me3 data can be obtained with the commands:

<<mosaicsFitHMM-pre,eval=TRUE>>=
constructBins( infile=system.file( file.path("extdata","wgEncodeBroadHistoneGm12878H3k4me3StdAlnRep1_chr22_sorted.bam"), package="mosaicsExample"), 
    fileFormat="bam", outfileLoc="./", 
    byChr=FALSE, useChrfile=FALSE, chrfile=NULL, excludeChr=NULL, 
    PET=FALSE, fragLen=200, binSize=200, capping=0 )
constructBins( infile=system.file( file.path("extdata","wgEncodeBroadHistoneGm12878ControlStdAlnRep1_chr22_sorted.bam"), package="mosaicsExample"), 
    fileFormat="bam", outfileLoc="./", 
    byChr=FALSE, useChrfile=FALSE, chrfile=NULL, excludeChr=NULL, 
    PET=FALSE, fragLen=200, binSize=200, capping=0 )

fileName <- c(
    "wgEncodeBroadHistoneGm12878H3k4me3StdAlnRep1_chr22_sorted.bam_fragL200_bin200.txt",
    "wgEncodeBroadHistoneGm12878ControlStdAlnRep1_chr22_sorted.bam_fragL200_bin200.txt")

binHM <- readBins( type=c("chip","input"), fileName=fileName)
fitHM <- mosaicsFit( binHM, analysisType="IO", bgEst="rMOM" )
@

By taking the MOSAiCS model fit from `\texttt{mosaicsFit}' as an input, users can fit MOSAiCS-HMM with the command:

<<mosaicsFitHMM,eval=TRUE>>=
hmmHM <- mosaicsFitHMM( fitHM, signalModel = "2S", 
	init="mosaics", init.FDR = 0.05, parallel=FALSE, nCore=8 )
@

The following command prints out BIC values of MOSAiCS and MOSAiCS-HMM models
so that users can determine whether it is beneficial to consider broad peaks using the MOSAiCS-HMM model.
As before, a lower BIC value indicates a better model fit
and in this H3K4me3 example, it is beneficial to consider the MOSAiCS-HMM model.

<<mosaicshmmfit-show>>=
hmmHM
@

`\texttt{plot}' method also provides the GOF plot, which allows visual
comparisons of the fits of the background, MOSAiCS, and MOSAiCS-HMM models with the actual data. Figure \ref{fig:mosaicshmmfit-plot} displays the GOF plot for our dataset. 

<<mosaicshmmfit-plot,eval=FALSE>>=
plot(hmmHM)
@

\begin{figure}[tb]
\begin{center}
<<fig-mosaicshmmfit-plot,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot(hmmHM)
@
\caption{\label{fig:mosaicshmmfit-plot} Goodness of Fit (GOF) plot. Depicted are
actual data for ChIP and control samples with simulated data from the following
fitted models: (Sim:Null): Background model; (Sim:MOSAiCS): MOSAiCS
model; (Sim:MOSAiCS-HMM): MOSAiCS-HMM model. }
\end{center}
\end{figure}

`\texttt{mosaicsPeakHMM}' calls peaks based on the MOSAiCS-HMM model fit. `\texttt{mosaicsPeakHMM}' allows two approaches, Viterbi algorithm (`\texttt{decoding="viterbi"}') and posterior decoding (`\texttt{decoding="posterior"}'), to call peaks. When posterior decoding is used (default), users can specify FDR level for the posterior decoding in the argument `\texttt{FDR}'. `\texttt{mosaicsPeakHMM}' provides its output as `\texttt{MosaicsPeak}' class object, which `\texttt{mosaicsPeak}' also generates. Hence, all the methods used for the output of `\texttt{mosaicsPeak}' can also be used for the output of `\texttt{mosaicsPeakHMM}', e.g., `\texttt{export}', `\texttt{print}', and `\texttt{show}'. Users can call peaks based on the MOSAiCS-HMM model fit with the command:

<<mosaicsPeakHMM,eval=TRUE>>=
peakHM <- mosaicsPeakHMM( hmmHM, FDR = 0.05, decoding="posterior",
  thres=10, parallel=FALSE, nCore=8 )
@

Note that `\texttt{mosaicsFitHMM}' and `\texttt{mosaicsPeakHMM}' fits MOSAiCS-HMM model and calls peaks for each chromosome separately. Hence, whenever multiple cores are available, it is strongly recommended to utilize parallel processing by setting `\texttt{parallel=TRUE}' and specifying the number of available cores in the argument `\texttt{nCore}'.

\section{Post-processing Steps after Peak Calling}\label{postprocessing}

\subsection{Identification of Peak Summits}\label{findSummit}

In the case of punctuated peaks, such as regions bound by transcription factors,
a peak summit (i.e., genomic position with the highest ChIP profile) can potentially be considered
as exact location of protein-DNA interaction.
`\texttt{mosaics}' package provides functionality to identify a peak summit
for each peak region identified using `\texttt{mosaicsPeak}' or  `\texttt{mosaicsPeakHMM}' methods.

As `\texttt{mosaics}' package uses only information from bin-level data until this step,
users first need to incorporate read-level data to identify peak summits.
In this section, we consider H3K4me3 data as an example because this read-level data will also be needed in next sections discussing broad peaks.
Read-level data can be loaded and incorporated into `\texttt{MosaicsPeak}' object, 
by applying `\texttt{extractReads}' method to `\texttt{MosaicsPeak}' object.
The `\texttt{extractReads}' function supports the same set of aligned read file formats
supported in the `\texttt{constructBins}' function.

<<summit-extractreads,eval=TRUE>>=
peakHM <- extractReads( peakHM,
  chipFile=system.file( file.path("extdata","wgEncodeBroadHistoneGm12878H3k4me3StdAlnRep1_chr22_sorted.bam"), package="mosaicsExample"),
  chipFileFormat="bam", chipPET=FALSE, chipFragLen=200,
  controlFile=system.file( file.path("extdata","wgEncodeBroadHistoneGm12878ControlStdAlnRep1_chr22_sorted.bam"), package="mosaicsExample"), 
  controlFileFormat="bam", controlPET=FALSE, controlFragLen=200, parallel=FALSE, nCore=8 )
peakHM
@

Users can now identify peak summits by applying `\texttt{findSummit}' method to `\texttt{MosaicsPeak}' object:

<<summit-findsummit,eval=TRUE>>=
peakHM <- findSummit( peakHM, parallel=FALSE, nCore=8 )
@

Locations of peak summits are now incorporated as the last column in the peak list:

<<summit-findsummit-print>>=
head(print(peakHM))
@

\subsection{Adjust Peak Boundaries and Filter Out Potentially False Positive Peaks}\label{postprocess}

While `\texttt{mosaicsPeakHMM}' provides initial peak calling based on the MOSAiCS-HMM model, we found that these peak calling results can be improved further by post-processing (boundary adjustment and peak filtering). Note that we developed and tested these post-processing steps mainly for broad peaks of histone modifications. While these functions can also be applied to punctuated peaks of transcription factors without any restrictions, parameters for these functions might not be optimal for punctuated peaks.

`\texttt{adjustBoundary}' method checks the ChIP read counts and the ratio of ChIP signal over matched control signal at boundaries and trims/extends peak boundaries to obtain more accurate boundaries:

<<postprocess-adjustboundary>>=
peakHM <- adjustBoundary( peakHM, parallel=FALSE, nCore=8 )
peakHM
head(print(peakHM))
@

Its summary output indicates that boundaries of 842 peaks are trimmed among 2,424 peaks called using `\texttt{mosaicsPeakHMM}' method. As such peak boundary adjustment can also affect peak summit identification (note that a peak summit should be located within its peak boundaries), peak summits are re-calculated after peak boundaries are adjusted. In this example, locations of 155 peak summits are changed by the peak boundary adjustment procedure.

`\texttt{filterPeak}' further checks the ChIP signal and the ratio of ChIP signal over matched control signal at the peak summit, in addition to the peak length, and filters out potentially false positive peaks:

<<postprocess-filterpeak>>=
peakHM <- filterPeak( peakHM, parallel=FALSE, nCore=8 )
peakHM
head(print(peakHM))
@

`\texttt{filterPeak}' employs two-step approach for peak filtering and its summary shows the peak filtering results after each step. The summary indicates that about half of the initial peaks (i.e., called using `\texttt{mosaicsPeakHMM}') are filtered out after the first filtering step. Among the remaining peaks, about half of the peaks are further filtered out in the second step. After the peak filtering step using the `\texttt{filterPeak}' method, we have 434 peaks for H3K4me3.

\subsection{Visualization of ChIP Profile of Peak Regions}\label{peakplot}

It is important to check ChIP profile to confirm that we have reasonable peak calling results.
While \texttt{mosaics} package provides functionality to generate wiggle files
for the use with genome browsers (See Section \ref{generateWig} for more details),
users can also generate ChIP profile plots of peak regions directly from \texttt{mosaics} package
for quick inspection of peak calling results.

In order to generate ChIP profile plots of peak regions, 
users first need to load read-level data using `\texttt{extractReads}' method,
as illustrated in Section \ref{findSummit}.
If `\texttt{extractReads}' method is already applied to `\texttt{MosaicsPeak}' object,
users can generate ChIP profile plots of all the peak regions 
and save them as a single PDF file named `\texttt{peakplot.pdf}' by the command:

<<summit-findsummit-plot, eval=FALSE>>=
plot( peakHM, filename="./peakplot.pdf" )
@

If users are interested only in some specific peak regions,
users can specify peak regions to plot their ChIP profiles with the argument `\texttt{peakNum}'.
The input to argument `\texttt{peakNum}' can be a vector, 
where elements indicate the row indexes in the peak list.
For example, the 8-th peak of H3K4me3 is located at chr22:18120496-18122661 and 
18-th peak of STAT1 factor overlaps this H3K4me3 peak:

<<summit-findsummit-plot-peaknum-print, eval=TRUE>>=
print(peakHM)[8,]
print(peakTFBS)[18,]
@

We can plot the ChIP profile of this H3K4me3 peak with command:

<<summit-findsummit-plot-peaknum, eval=FALSE>>=
plot( peakHM, peakNum=8 )
@

Figure \ref{fig:peakplot} shows ChIP profile plot of H3K4me3 generated using `\texttt{plot}' method. It indicates there is actually strong bimodal ChIP signal in this region.

\begin{figure}[tb]
\begin{center}
<<fig-summit-findsummit-plot-peaknum-hm,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot( peakHM, peakNum=8 )
@
\caption{\label{fig:peakplot} Example ChIP profile plot of H3K4me3 modification in GM12878 cell line.}
\end{center}
\end{figure}

For more extensive investigation, the wiggle files for STAT1 and H3K4me3 generated using `\texttt{generateWig}' method can be used for genome browsers. Figure \ref{fig:IGV} shows the IGV screenshot of ChIP-seq data of STAT1 and H3K4me3 in the promoter region of BCL2L13, where the 8-th peak of H3K4me3 is located at. It shows that there are overlapping STAT1 binding and H3K4me3 modification in the promoter region of BCL2L13 gene, as suggested by the MOSAiCS and MOSAiCS-HMM peak calling results. This might indicate that BCL2L13 is a target gene of STAT factor and this gene is also transcribed in GM12878 cell line.

\begin{figure}[ht]
\centering
\includegraphics[width=0.8\textwidth] {igv.pdf}
\caption{IGV screenshot of ChIP-seq data of STAT1 and H3K4me3 at the promoter region of BCL2L13.
\label{fig:IGV} }
\end{figure}

\section{Two-Sample Analysis using \texttt{'mosaicsRunAll'}}\label{mosaicsRunAll}

Two-sample analysis without mappability and GC content can also be done 
in a more convenient way, with the command: 

<<mosaicsRunAll,eval=FALSE>>=
     mosaicsRunAll( 
         chipFile="/scratch/eland/STAT1_ChIP_eland_results.txt", 
         chipFileFormat="eland_result", 
         controlFile="/scratch/eland/STAT1_control_eland_results.txt", 
         controlFileFormat="eland_result", 
         binfileDir="/scratch/bin/", 
         peakFile=c("/scratch/peak/STAT1_peak_list.bed", 
                    "/scratch/peak/STAT1_peak_list.gff"),
         peakFileFormat=c("bed", "gff"),
         reportSummary=TRUE, 
         summaryFile="/scratch/reports/mosaics_summary.txt", 
         reportExploratory=TRUE, 
         exploratoryFile="/scratch/reports/mosaics_exploratory.pdf", 
         reportGOF=TRUE, 
         gofFile="/scratch/reports/mosaics_GOF.pdf",
         byChr=FALSE, useChrfile=FALSE, chrfile=NULL, excludeChr="chrM",
         PET=FALSE, FDR=0.05, fragLen=200, binSize=fragLen, capping=0,
         bgEst="rMOM", signalModel="BIC", parallel=TRUE, nCore=8 )
@

`\texttt{mosaicsRunAll}' method imports aligned read files, converts them to bin-level files (generated bin-level files will be saved in the directory 
specified in `\texttt{binfileDir}' argument for future use),
fits the MOSAiCS model, identifies peaks, and exports the peak list. 
In addition, users can also make `\texttt{mosaicsRunAll}' method generate diverse analysis reports, 
such as summary report of parameters and analysis results, exploratory plots, and goodness of fit (GOF) plots.
Arguments of `\texttt{mosaicsRunAll}' method are summarized in Table \ref{tab:mosaicsRunAll}.
See Section \ref{constructBins} for
details of the arguments `\texttt{chipFileFormat}', `\texttt{controlFileFormat}',
`\texttt{byChr}', `\texttt{useChrfile}', `\texttt{chrfile}', `\texttt{excludeChr}', 
`\texttt{PET}', `\texttt{fragLen}', `\texttt{binSize}', and `\texttt{capping}'. 
See Section \ref{mosaicsFit}' for details of the argument `\texttt{bgEst}'. 
See Section \ref{mosaicsPeak}' for details of the arguments
`\texttt{FDR}', `\texttt{signalModel}', `\texttt{peakFileFormat}',
`\texttt{maxgap}', `\texttt{minsize}', and `\texttt{thres}'.

\begin{table}
\caption{ \label{tab:mosaicsRunAll} \textbf{Summary of the arguments of `\texttt{mosaicsRunAll}' method.} }
\label{t:case}
\begin{center}
\begin{tabular}{ll}
\multicolumn{2}{c}{(a) Input and output files} \\
\hline
Argument & Explanation \\
\hline
\texttt{chipFile} & Name of aligned read file of ChIP sample.\\
\texttt{chipFileFormat} & File format of aligned read file of ChIP sample.\\
\texttt{controlFile} & Name of aligned read file of matched control sample.\\
\texttt{controlFileFormat} & File format of aligned read file of matched control sample.\\
\texttt{binfileDir} & Directory that bin-level files are exported to.\\
\texttt{peakFile} & Vector of file names of peak list.\\
\texttt{peakFileFormat} & Vector of file formats of peak list.\\
\hline
\multicolumn{2}{c}{} \\
\multicolumn{2}{c}{(b) Reports} \\
\hline
Argument & Explanation \\
\hline
\texttt{reportSummary} * & Generate analysis summary? \\
\texttt{summaryFileName} & File name of analysis summary. \\
\texttt{reportExploratory} * & Generate exploratory plots? \\
\texttt{exploratoryFileName} & File name of exploratory plots. \\
\texttt{reportGOF} * & Generate GOF plots? \\
\texttt{gofFileName} & File name of GOF plots. \\
\hline
\multicolumn{2}{l}{* Reports will be generated only when these arguments are \texttt{TRUE}. Default is \texttt{FALSE}.} \\
\multicolumn{2}{c}{} \\
\multicolumn{2}{c}{(c) Tuning parameters} \\
\hline
Argument & Explanation \\
\hline
\texttt{byChr} & Genome-wide analysis (\texttt{FALSE}) or chromosome-wise analysis (\texttt{TRUE})? \\
\texttt{useChrfile} & Use the file containing chromosome ID and chromosome size? \\
\texttt{chrfile} & Name of the file containing chromosome ID and chromosome size. \\
\texttt{excludeChr} & Vector of chromosomes to be excluded from the analysis. \\
\texttt{fragLen} & Average fragment length. \\
\texttt{binSize} & Bin size. \\
\texttt{capping} & Cap read counts in aligned read files? \\
\texttt{bgEst} & Background estimation approach. \\
\texttt{signalModel} & Signal model. \\
\texttt{PET} & Paired-end tag (\texttt{TRUE}) or single-end tag (\texttt{FALSE}) ChIP-Seq data? \\
\texttt{FDR} & False discovery rate (FDR). \\
\texttt{maxgap} & Distance between initial peaks for merging. \\
\texttt{minsize} & Minimum width to be called as a peak. \\
\texttt{thres} & Minimum ChIP tag counts to be called as a peak. \\
\texttt{parallel} & Use \texttt{parallel} package for parallel computing? \\
\texttt{nCore} & Number of CPUs used for parallel computing. ** \\
\hline
\multicolumn{2}{l}{** Relevant only when \texttt{parallel=TRUE} and \texttt{parallel} package is installed.} \\
\end{tabular}
\end{center}
\end{table}

\section{Two-Sample Analysis with Mappability and GC Content}\label{two_sample_MGC}

For the two-sample analysis with mappability and GC content and the one-sample analysis,
you also need bin-level mappability, GC content, and sequence ambiguity 
score files for the reference genome you are working with.
If you are working with organisms such as human (HG18 and HG19), mouse (MM9), 
rat (RN4), and Arabidopsis (TAIR9), you can download their corresponding 
preprocessed mappability, GC content, and sequence ambiguity score files 
at \url{http://www.stat.wisc.edu/~keles/Software/mosaics/}. 
If your reference genome of interest is not listed on our website, 
you can inquire about it at our Google group, 
\url{http://groups.google.com/group/mosaics_user_group}, and we would be happy 
to add your genome of interest to the list. 
The companion website also provides 
all the related scripts and easy-to-follow instructions to prepare these files. 
Please check \url{http://www.stat.wisc.edu/~keles/Software/mosaics/} 
for more details.

In this section, we use chromosome 21 data from a ChIP-seq
experiment of STAT1 binding in interferon-$\gamma$-stimulated HeLa S3 cells \cite{stat1}. 
`\texttt{mosaicsExample}' package also provides this example dataset.
You can import bin-level data and fit MOSAiCS model 
for the two-sample analysis using mappability and GC content with the commands:

<<ts-readbin>>=
exampleBinData <- readBins( type=c("chip","input","M","GC","N"),
    fileName=c( system.file( file.path("extdata","chip_chr21.txt"), package="mosaicsExample"),
    system.file( file.path("extdata","input_chr21.txt"), package="mosaicsExample"),
    system.file( file.path("extdata","M_chr21.txt"), package="mosaicsExample"),
    system.file( file.path("extdata","GC_chr21.txt"), package="mosaicsExample"),
    system.file( file.path("extdata","N_chr21.txt"), package="mosaicsExample") ) )
@

For the  `\texttt{type}' argument, \texttt{"chip"}, \texttt{"input"},
\texttt{"M"}, \texttt{"GC"}, and \texttt{"N"} indicate bin-level ChIP data, 
control sample data, mappability score, GC content score, and sequence
ambiguity score, respectively.

When you have mappability and GC contents, 
`\texttt{plot}' method provides additional plot types.
`\texttt{plotType="M"}' and `\texttt{plotType="GC"}' generate plots of mean
ChIP tag counts versus mappability and GC content scores, respectively.
Moreover, `\texttt{plotType="M|input"}' and
`\texttt{plotType="GC|input"}' generate plots of mean ChIP tag counts versus
mappability and GC content scores, respectively, conditional on control tag
counts.

<<ts-bindata-plot>>=
plot( exampleBinData, plotType="M" )
plot( exampleBinData, plotType="GC" )
plot( exampleBinData, plotType="M|input" )
plot( exampleBinData, plotType="GC|input" )  
@

As discussed in \cite{mosaics}, 
we observe that mean ChIP tag count increases as mappability score increases
(Figure \ref{fig:bindata-plot-M}). Mean ChIP tag count depends on GC score
in a non-linear fashion (Figure \ref{fig:bindata-plot-GC}). 
When we condition on control tag counts (Figures \ref{fig:bindata-plot-M-input}
and \ref{fig:bindata-plot-GC-input}), mean ChIP tag count versus mappability
and GC content relations exhibit similar patterns to that of marginal plots
given in Figures  \ref{fig:bindata-plot-M} and \ref{fig:bindata-plot-GC}.
MOSAiCS incorporates this observation by modeling ChIP tag counts from non-peak
regions with a small number of control tag counts as a function of
mappability, GC content, and control tag counts.

\begin{figure}[tb]
\begin{center}
<<fig-bindata-plot-M,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot( exampleBinData, plotType="M" )
@
\caption{\label{fig:bindata-plot-M} Mean ChIP tag count versus Mappability.}
\end{center}
\end{figure}

\begin{figure}[tb]
\begin{center}
<<fig-bindata-plot-GC,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot( exampleBinData, plotType="GC" )
@
\caption{\label{fig:bindata-plot-GC} Mean ChIP tag count versus GC content.}
\end{center}
\end{figure}

\begin{figure}[tb]
\begin{center}
<<fig-bindata-plot-M-input,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot( exampleBinData, plotType="M|input" )
@
\caption{\label{fig:bindata-plot-M-input} Mean ChIP tag count versus
Mappability, conditional on control tag counts.}
\end{center}
\end{figure}

\begin{figure}[tb]
\begin{center}
<<fig-bindata-plot-GC-input,fig=TRUE,height=5,width=5,echo=FALSE>>=
plot( exampleBinData, plotType="GC|input" )
@
\caption{\label{fig:bindata-plot-GC-input} Mean ChIP tag count versus
GC content, conditional on control tag counts.}
\end{center}
\end{figure}

Application of MOSAiCS to multiple case studies of ChIP-seq data
with low sequencing depth showed that consideration of
mappability and GC content in the model improves sensitivity and specificity 
of peak identification even in the presence of a control sample \cite{mosaics}.
\texttt{mosaics} package accommodates a two-sample analysis with
mappability and GC content by specification of `\texttt{analysisType="TS"}'
when calling the `\texttt{mosaicsFit}' method.

<<ts-mosaicsfit,eval=FALSE>>=
exampleFit <- mosaicsFit( exampleBinData, analysisType="TS", bgEst="automatic" )
@

Peak identification can be done exactly in the same way
as in the case of the two-sample analysis without mappability and GC content.

<<os-mosaicspeak,eval=FALSE>>=
OneSamplePeak <- mosaicsPeak( OneSampleFit, signalModel="2S", FDR=0.05,
maxgap=200, minsize=50, thres=10 )
@
         
\section{One-Sample Analysis}\label{one_sample}

When control sample is not available, `\texttt{mosaics}' package accommodates
one-sample analysis of ChIP-seq data. Implementation of the MOSAiCS one-sample
model is very similar to that  of  the two-sample analysis. Bin-level data for
the one-sample analysis can be imported to the R environment with the command:

<<os-readbin,eval=FALSE>>=
exampleBinData <- readBins( type=c("chip","M","GC","N"),
    fileName=c( system.file( file.path("extdata","chip_chr21.txt"), package="mosaicsExample"),
    system.file( file.path("extdata","M_chr21.txt"), package="mosaicsExample"),
    system.file( file.path("extdata","GC_chr21.txt"), package="mosaicsExample"),
    system.file( file.path("extdata","N_chr21.txt"), package="mosaicsExample") ) )
@

%Note that you don't need to provide `\texttt{"input"}' in `\texttt{type}' and
%the file name of  a control dataset in `\texttt{fileName}' here. 
In order to fit a MOSAiCS model for the one-sample analysis, you need to specify
`\texttt{analysisType="OS"}' %instead of `\texttt{analysisType="TS"}' 
when calling  the `\texttt{mosaicsFit}' method.

<<os-mosaicsfit,eval=FALSE>>=
exampleFit <- mosaicsFit( exampleBinData, analysisType="OS", bgEst="automatic" )
@

Peak identification can be done exactly in the same way as in the case 
of the two-sample analysis.

<<os-mosaicspeak,eval=FALSE>>=
examplePeak <- mosaicsPeak( exampleFit, signalModel="2S", FDR=0.05,
maxgap=200, minsize=50, thres=10 )
@

%\section{Tuning Parameters to Improve the MOSAiCS Fit}\label{tuning}
\section{Case Studies: Tuning Parameters to Improve the MOSAiCS Fit}\label{case_studies}

Because the \texttt{mosaics} package is based on the statistical modeling approach,
it is important to check that we have nice model fits.
Goodness of fit (GOF) plots generated from the `\texttt{plot}' method
are key tools that users can utilize to check the MOSAiCS fit and improve it if necessary.
In this section, we will discuss several case studies based on real ChIP-Seq data,
especially focusing on understanding unsatisfactory MOSAiCS fits and suggesting strategies to improve it.
The case studies illustrated in this section are based on \cite{bookchapter}
and we provided deeper discussion and example analysis codes in this book chapter.

%\begin{figure}[ht]
%\centering
%\subfigure[]{
%   \includegraphics[width=0.5\textwidth] {Figure4a.pdf}
% }
%\subfigure[]{
%   \includegraphics[width=0.5\textwidth] {Figure4b.pdf}
% }
%\caption{ \label{fig:case_studies_histogram} }
%\end{figure}

\subsection{Case 1}

\begin{figure}[ht]
\centering
\subfigure[When the background estimation approach was automatically chosen]{
   \includegraphics[width=0.5\textwidth] {GOF_matchLow.pdf}
 }
\subfigure[When the background estimation approach was explicitly specified]{
   \includegraphics[width=0.5\textwidth] {GOF_rMOM.pdf}
 }
\caption{ Case \#1. Goodness of fit when the background estimation approach was automatically chosen by \texttt{mosaics} package (a) and explicitly specified as robust method of moment (b). The MOSAiCS fit was significantly improved by explicitly specifying the background estimation approach. \label{fig:case_studies_GOF_no1} }
\end{figure}

Figure \ref{fig:case_studies_GOF_no1}a shows the GOF plot for the two-sample analysis without using mappability and GC content. The GOF plot indicates that ChIP tag counts simulated from the fitted model are on average higher than the actual ChIP-Seq data. Moreover, estimated background dominates in the fitted model. In such cases (\textit{over-estimation of background}), we usually have much smaller number of peaks. This problem occurred essentially because `\texttt{mosaicsFit}' guessed using bins with low ChIP tag counts (`\texttt{bgEst="matchLow"}') as the optimal background estimation approach, from its automatic selection (`\texttt{bgEst="automatic"}'). Although automatic selection usually works well, there are some cases that it does not result in optimal background estimation approach. In this case, the MOSAiCS fit can be improved by explicitly specifying the background estimation approach with the command:

<<tuning-case1,eval=FALSE>>=
exampleFit <- mosaicsFit( exampleBinData, analysisType="IO", bgEst="rMOM" )
@

Figure \ref{fig:case_studies_GOF_no1}b shows that the MOSAiCS fit was significantly improved by explicitly using the robust method of moment approach (`\texttt{bgEst="rMOM"}').

\subsection{Case 2}

\begin{figure}[ht]
\centering
\subfigure[`\texttt{truncProb = 0.999}' (default)]{
   \includegraphics[width=0.5\textwidth] {Figure5c.pdf}
 }
\subfigure[`\texttt{truncProb = 0.80}']{
   \includegraphics[width=0.5\textwidth] {Figure5d.pdf}
 }
\caption{ Case \#2. Goodness of fit when default `\texttt{truncProb}' value (0.999) is used (a) and `\texttt{truncProb = 0.80}' is explicitly specified (b). The MOSAiCS fit was significantly improved by lowering the `\texttt{truncProb}' value.
\label{fig:case_studies_GOF_no2} }
\end{figure}

Figure \ref{fig:case_studies_GOF_no2}a shows the GOF plot for the two-sample analysis without using mappability and GC content. The GOF plot indicates that the MOSAiCS fit is unsatisfactory for the bins with low ChIP tag counts. This problem occurred essentially because background estimation was affected by some bins with high tag counts in the matched control data. In the two-sample analysis without using mappability and GC content, the `\texttt{truncProb}' argument indicates proportion of bins that are not considered as outliers in the control data and it controls the functional form used for the control data. Although our empirical studies indicates that default `\texttt{truncProb}' value usually works well, there are some cases that it does not result in optimal background estimation. In this case, the MOSAiCS fit can be improved by lowering the `\texttt{truncProb}' value with the command: 

<<tuning-case2,eval=FALSE>>=
exampleFit <- mosaicsFit( exampleBinData, analysisType="IO", 
	bgEst="automatic", truncProb=0.80 )
@

Figure \ref{fig:case_studies_GOF_no2}b shows that the MOSAiCS fit was significantly improved by using `\texttt{truncProb = 0.80}'.

\subsection{Case 3}

\begin{figure}[ht]
\centering
\subfigure[Two-sample analysis without mappability and GC content]{
   \includegraphics[width=0.5\textwidth] {Figure5a.pdf}
 }
\subfigure[Two-sample analysis with mappability and GC content]{
   \includegraphics[width=0.5\textwidth] {Figure5b.pdf}
 }
\caption{ Case \#3. Goodness of fit for the two-sample analysis without utilizing mappability and GC content (a). The MOSAiCS fit was improved when we use the two-sample analysis utilizing mappability and GC content (b).
\label{fig:case_studies_GOF_no3} }
\end{figure}

Figure \ref{fig:case_studies_GOF_no3}a displays the GOF plot for the two-sample analysis without utilizing mappability and GC content. Neither the blue (two-signal component) nor the red (one-signal component) curve provides good fit to the ChIP data. In this case, we consider fitting a two-sample analysis with mappability and GC content. Figure \ref{fig:case_studies_GOF_no3}b displays the GOF plot for the two-sample analysis with mappability and GC content in addition to Input and the goodness of fit improves significantly by utilizing mappability and GC content. 

\subsection{Note on Parameter Tuning}

Overall, unsatisfactory model fits can be improved via the tuning parameters in the `\texttt{mosaicsFit}' function. Our empirical studies suggest that as the sequencing depths are getting larger, genomic features mappability and GC content have less of an impact on the overall model fit. In particular, we suggest tuning the the two-sample model without mappability and GC content in the cases of unsatisfactory fits before switching to a fit with mappability and GC content. The following are some general tuning suggestions: for the two-sample analysis without utilizing mappability and GC content, lowering the value of the `\texttt{truncProb}' parameter; for the two-sample analysis with mappability and GC content, a larger `\texttt{s}' parameter and a smaller `\texttt{meanThres}' parameter; for the one-sample analysis with mappability and GC content, varying the `\texttt{meanThres}' parameter are the general tuning guidelines. Although MOSAiCS has two additional tunable parameters, `\texttt{k}' and `\texttt{d}', we have accumulated ample empirical evidence through analyzing many datasets that the default values of `\texttt{k = 3}' and `\texttt{d = 0.25}' work well for these parameters \cite{bookchapter}. If you encounter a fitting problem you need help with, feel free to contact us at our Google group, \url{http://groups.google.com/group/mosaics_user_group}.

%In the two-sample analysis using mappability and GC content, users can control three tuning parameters: `\texttt{s}', `\texttt{d}', and `\texttt{meanThres}'.  `\texttt{s}' and `\texttt{d}' are parameters of the background distribution and control the functional form used for the control data. Please see \cite{mosaics} for further details on these two model parameters. `\texttt{meanThres}' controls the number of strata used at the robust linear regression modeling step of the background distribution fitting. `\texttt{mosaics}' package uses the following parameter setting as default:

%<<tuning-ts,eval=FALSE>>=
%exampleFit <- mosaicsFit( exampleBinData, analysisType="TS", 
%	bgEst="automatic", meanThres=1, s=2, d=0.25 )
%@

%Users might need to consider parameter tuning especially when the fitted background model is too similar to the actual data, resulting in too few peaks. If such cases are detected or predicted, `\texttt{mosaicsFit}' prints out warning or error messages. You may also be able to detect this case using the GOF plot. Using a higher `\texttt{s}' value and lower `\texttt{meanThres}' often solves the problem, e.g., `\texttt{s = 6}' and `\texttt{meanThres = 0}'.

%In addition to `\texttt{analysisType}', `\texttt{mosaicsFit}' method provides parameters to tune the background distribution of the MOSAiCS model. We specified appropriate default values for these parameters based on computational experiments and analysis of diverse ChIP-seq datasets. Default values work well in general but some tuning might be required for some cases. You may need to consider parameter tuning if the fitted background model is too similar to the actual data in the GOF plot or you encounter some warning or error messages while running `\texttt{mosaicsFit}' method. Section \ref{tuning} provides basic guidelines on parameter tuning. If you encounter a fitting problem you need help with, feel free to contact us at our Google group, \url{http://groups.google.com/group/mosaics_user_group}.

\section{Conclusion and Ongoing Work}\label{conclusion}

R package \texttt{mosaics} provides effective tools to read and investigate
ChIP-seq data, fit MOSAiCS model, and identify peaks. We are continuously
working on improving \texttt{mosaics} package further, especially in supporting
more diverse genomes, automating fitting procedures, developing more friendly
and easy-to-use user interface, and providing more effective data investigation
tools. Please post any questions or requests regarding `\texttt{mosaics}'
package at \url{http://groups.google.com/group/mosaics_user_group}. Updates and
changes of `\texttt{mosaics}' package will be announced at our Google group and
the companion website (\url{http://www.stat.wisc.edu/~keles/Software/mosaics/}).

\section*{Acknowledgements}

We thank Gasch, Svaren, Chang, Kiley, Bresnick, Pike, and Donohue Labs at the University of Wisconsin-Madison for sharing their data for MOSAiCS analysis and useful discussions. We also thank Colin Dewey and Bo Li for the CSEM output in Appendix A.7. 

\begin{thebibliography}{99}
\bibitem{mosaics} Kuan, PF, D Chung, G Pan, JA Thomson, R Stewart, and S Kele\c{s}
(2010), ``A Statistical Framework for the Analysis of ChIP-Seq Data'',
\textit{Journal of the American Statistical Association}, 106, 891-903.
\bibitem{mosaicsHMM} Chung, D, Zhang Q, and Kele\c{s} S (2014), 
``MOSAiCS-HMM: A model-based approach for detecting regions of histone modifications from ChIP-seq data'',
Datta S and Nettleton D (eds.), \textit{Statistical Analysis of Next Generation Sequencing Data}, Springer.
\bibitem{stat1} Rozowsky, J, G Euskirchen, R Auerbach, D Zhang, T Gibson, 
R Bjornson, N Carriero, M Snyder, and M Gerstein (2009), ``PeakSeq enables
systematic scoring of ChIP-Seq experiments relative to controls'',
\textit{Nature Biotechnology}, 27, 66-75.
\bibitem{bookchapter} Sun, G, D Chung, K Liang, S Kele\c{s} (2012), 
``Statistical Analysis of ChIP-Seq Data with MOSAiCS'',
\textit{Methods in Molecular Biology}, 1038, 193-212.
\end{thebibliography}

\appendix

\clearpage

\section{Appendix: Example Lines of Aligned Read Files for SET ChIP-Seq Data}\label{example_aligned_SET}

\subsection{Eland Result File Format}

\begin{verbatim}
>HWUSI-EAS787_0001:6:1:2020:1312#NTAGGC/1	TTGCGGGTTAACAAAAACGATGTAAACCATCG	U0	1	0	0	U00096	3894480	F	..
>HWUSI-EAS787_0001:6:1:2960:1312#NTAGGC/1	TATTTTCCTGGTTCTGCTGCTGGTGAGCGGCG	U0	1	0	0	U00096	4079496	R	..
>HWUSI-EAS787_0001:6:1:3045:1310#NTAGGC/1	AGCGTATCAAAACTGACAATTCATTCTATGAA	U0	1	0	0	U00096	2087194	F	..
>HWUSI-EAS787_0001:6:1:3887:1310#NTAGGC/1	TCCGAGTTGTCGCAATGGGGGCAAGGTGTGAA	U1	0	1	0	U00096	2405216	R	..	26C
>HWUSI-EAS787_0001:6:1:3993:1315#TTAGGC/1	AGACATAGTAAAACCGATACCGCACAGGATCC	U0	1	0	0	U00096	18483	R	..
>HWUSI-EAS787_0001:6:1:4156:1312#NTAGGC/1	GCCGAACTGACAAATAAAATAGCCTGATAGGA	U0	1	0	0	U00096	2687648	F	..
>HWUSI-EAS787_0001:6:1:4215:1310#NTAGGC/1	GGAATTTCACGAAAACAGAGCTAAAGCGCCGT	U0	1	0	0	U00096	4569776	F	..
>HWUSI-EAS787_0001:6:1:4458:1311#NTAGGC/1	GTTCCTGGCAGGGATTCGGCGCACTCGCCCAC	U0	1	0	0	U00096	3607517	F	..
>HWUSI-EAS787_0001:6:1:4841:1308#NTAGGC/1	GGCGTGTGCATCAGCAGAATTTTTCGGGCGGT	U0	1	0	0	U00096	3715588	R	..
>HWUSI-EAS787_0001:6:1:5215:1316#TTAGGC/1	TGATATTCTCCGCAGCCAGACTTTTTCCGCCA	U0	1	0	0	U00096	668432	R	..
\end{verbatim}

\subsection{Eland Extended File Format}

\begin{verbatim}
>SOLEXA2_1110:7:1:1599:1010#0/1	NNTTTATTTCAACAGGATACTAATATCCTAGGCCCTTTTC	1:0:0	chr21.fa:26418321RCT38
>SOLEXA2_1110:7:1:2734:1009#0/1	NNCCCCTCCAATGACTATAGCAATGATCTTCATGGTAGAT	1:0:0	chr18.fa:37353206RTC38
>SOLEXA2_1110:7:1:3130:1007#0/1	NNTCTTATATTCTTACGAAGCATCAGTCTTAGCAGAAACT	1:0:0	chr4.fa:141242065RCC38
>SOLEXA2_1110:7:1:3709:1009#0/1	NNAAAAAATACAAAAATTAGGCTGTGCACGGTGGTGCAGG	0:1:0	chr18.fa:12860297FCA25G6CT2T1
>SOLEXA2_1110:7:1:4887:1009#0/1	NNTTATATAACAATTCAACAACTATTTCTTGAGCATCTAA	1:0:0	chr13.fa:60908544RAA38
>SOLEXA2_1110:7:1:6298:1011#0/1	NNAGACACACATTTGTTTTTTGTATTTTTCACATCTCTTT	1:0:0	chr11.fa:47506195FAA38
>SOLEXA2_1110:7:1:7798:1011#0/1	NNAGACACTGAGATTTTATGATACTGATTATTGTCGCATT	1:0:0	chr11.fa:25291690FAC38
>SOLEXA2_1110:7:1:7970:1007#0/1	NNGGCTCCTAAAAAGCATACTTTTTTTTTGTTTTCTGTAT	0:0:1	chr21.fa:19842628RGA27^T$11
>SOLEXA2_1110:7:1:8051:1007#0/1	NNTCACATTACCTTTACTAATCCTGAGAGAGCAGGAACTC	1:0:0	chr7.fa:47191653FCA38
>SOLEXA2_1110:7:1:8422:1011#0/1	NNGGGCTTTTGGGGATGATGGTGTCACCAGGTGGGGAATT	1:0:0	chr1.fa:59480447RAA38
\end{verbatim}

\subsection{Eland Export File Format}

\begin{verbatim}
AMELIA	102	5	1	7564	6792	...T..	1	TCTCATTTTTTACGTTTTTCAGTGATTTCGTCATTTTTCAAGTCGTCAAG	ggggggggggggggggggggggeggggggggegggggeeggggggggggg	0:48:71											Y
AMELIA	102	5	1	7589	6796	...A..	1	TGTGCATTTCACATTTTTCACGTTTTTTAGTGATTTCGTCATTTTTCAAG	ggggggggggggggggggggggggggggfgeggggggggggggggggggg	chr2.fa		98506985	R	50	40						Y
AMELIA	102	5	1	7721	6804	...G..	1	TATGAGACAGTGGATATGTTATGTAATATCTCCAAGTCAACTTCTTTTCA	cca`caabbceceeaca\ccbccZc[[_\^a_\cbdcdc_YWRPXa^BBB	chrX.fa		18454546	F	50	190						Y
AMELIA	102	5	1	7516	6810	...C..	1	GGGACAGTTCTGCAGACTTGGGACTCCACTCTAGAGAGGAAGAAAGAGAG	RUQKUV[\]S_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB	chr1.fa		101923817	F	25A12A11	29						N
AMELIA	102	5	1	7650	6808	...C..	1	AGAGGTGCCTGCACCTCCAGCCACCTGGGAGGCTGTGTCAGGAGGATCAC	dddddaeffegggggegggfegggggggggabcdegg^eged`bdb]_cb	chr12.fa		80471182	F	50	203						Y
AMELIA	102	5	1	7703	6811	...C..	1	CTTTTAGATAACAATCCCATATTCAGGAAGTTTTATTCAATTCATTCAAG	gggfeggggffffgggggfgfgdgffgggfddfeddfff^gfgagggagg	chr4.fa		17871000	F	50	203						Y
AMELIA	102	5	1	7524	6826	...A..	1	ACTTCGCCTTACTGTAAGTGTATCTCACGCATGCAGAGCTCAGCAGCGGT	BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB	NM											N
AMELIA	102	5	1	7600	6825	...T..	1	GATATATAAATATTTATTATATGTAAAACACGTATTTTAAAGAACTTAAA	gggggfggfggfgffgfggfddeddgggdgfdaeeggaeeffdgegbgge	chr15.fa		57197391	R	50	203						Y
AMELIA	102	5	1	7564	6837	...A..	1	TTCGGCTTGGCAGCAAGCGCCAACTACCCCCTAAGCCAGCTTTCGAGCCT	bbbbbbbbK^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB	chr1.fa		129403054	R	29A20	27						N
AMELIA	102	5	1	7620	6840	...A..	1	CTTGACGACTTGAAAAATGACGAATTCACTAAAATACGTGAAAAAAGAGA	fggffgfdggeeffdfdffdedfgggfeeebddddfdfebbdd_dgggge	0:4:13											Y
\end{verbatim}

\subsection{Default Bowtie File Format}

\begin{verbatim}
HWI-EAS255_8232_FC30D82_6_1_11_1558	-	chr7	82587091	ATCTTGTTTTATCTTGAAAAGCAGCTTCCTTAAAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
HWI-EAS255_8232_FC30D82_6_1_12_793	+	chr4	33256683	GTTAATCGGGAAAAAAACCTTTTCCAGGAAAACAA	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
HWI-EAS255_8232_FC30D82_6_1_17_606	-	chr12	92751594	GCCTACATCCTCAGATTCATACATGTCACCATTTC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
HWI-EAS255_8232_FC30D82_6_1_29_1543	+	chr20	53004497	GTGACCTAGTTAAATACTGGCTCCACCTCTTGGAG	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
HWI-EAS255_8232_FC30D82_6_1_22_327	+	chr8	93861371	GAAATAGCAGGAGACAGGTACTTTATCTTGCTTTT	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
HWI-EAS255_8232_FC30D82_6_1_10_1544	-	chr4	121630802	TTCCCTAACATCTGTGTCAATTCTCTGTCAACTGC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
HWI-EAS255_8232_FC30D82_6_1_108_1797	+	chr8	131141865	GTTGAATGAAATGGATATGAAACAAAGCACTATAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
HWI-EAS255_8232_FC30D82_6_1_41_1581	-	chr7	16554954	CTCTTGCTCTCTTCATTAGTTTAGTTTTCTTCTAC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	22:G>T
HWI-EAS255_8232_FC30D82_6_1_12_787	-	chr8	119427380	CCCTAGAGGAGCTCAAAACAACTGCACAACACAAC	IIIEIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	23:T>C
HWI-EAS255_8232_FC30D82_6_1_6_1497	+	chr1	233856805	GTTAAAGGCGTTTGGATATGATGCAATTCCAAATC	IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII	0	
\end{verbatim}

\subsection{SAM File Format}

\begin{verbatim}
SALLY:187:B02JLABXX:5:1101:1418:1923	65	U00096	1943409	30	51M	*	0	0	GTTCGCGAATTAAAGTTTCACTGCTGGCGTCAGGGCGAGCGATTTTGCTCA	#1:DB??@F?DFFB@<E?CGCHIICHG<G?FH0B?76@FG=8?;;>DA@C>	NM:i:1	MD:Z:0C50
SALLY:187:B02JLABXX:5:1101:1441:1969	65	U00096	3310343	30	51M	*	0	0	GCGGACGCGCTTCACGCGGAACTTCAATGCCCTGACGCGCATATTCGTACA	#1=BDBDDHA?D?ECCGDE:7@BGCEI@CGGGICGHE6BABBBCDCC>A?@	NM:i:1	MD:Z:0T50
SALLY:187:B02JLABXX:5:1101:1685:1925	65	U00096	2164008	30	51M	*	0	0	GGCACTTCCCTGAAATGCCGATCCACCTTTCGGTGCAGGCTAACGCCGTGA	#1=DFFFFHHHGHIIIIIIIEHGIIIIIIIIIIFCHIIIIIHIGGGHH@BH	NM:i:1	MD:Z:0A50
SALLY:187:B02JLABXX:5:1101:1587:1933	65	U00096	2140205	30	51M	*	0	0	GGCCAGGCTTCAATATCTCGGTCACACAGACGCATGGCATTTTCTCCTTTC	#1=DDFFFHHHHGIJIIJJJJHIGIJJJJJJIJJJJJHIJJJJJJJJJJJJ	NM:i:1	MD:Z:0A50
SALLY:187:B02JLABXX:5:1101:1635:1986	81	U00096	1432777	30	51M	*	0	0	AACGTGCTGCGGTTGGTTTGACTTTGATTGAGACGTTTTGGAATTTTTTTC	HEJJJJJJJJIJJGJJJJJIHJJJJJJIGJJIHJJJJJHHHHHDFFFD=1#	NM:i:0	MD:Z:51
SALLY:187:B02JLABXX:5:1101:1607:2000	65	U00096	932738	30	51M	*	0	0	GGGCGTCATCAGTCCAGCGACGAATACATTGATTATTTTGCCGTTTCGCTA	#1=BDD?DFFFFFI<AE>GIFFBGFIIFGIBFIIFIEIIIFEF;ADFFAEI	NM:i:1	MD:Z:0T50
SALLY:187:B02JLABXX:5:1101:1937:1904	81	U00096	4541497	30	51M	*	0	0	AAACGTTGGTGTGCAGATCCTGGACAGAACGGGTGCTGCGCTGACGCTGGC	JJIJJJJJJJJJJJIJJJJJIHHIGIIJJJJJIGIJJJHHHHHFFFDD=4#	NM:i:1	MD:Z:50A0
SALLY:187:B02JLABXX:5:1101:1881:1942	65	U00096	4003009	30	51M	*	0	0	GGCTGCAGGAGCATGACAATCCGTTCACGCTCTATCCTTATGACACCAACT	#1:BDFA>FDHBHHIGHICFFGGHE3??FFEHGCCBFFC@FHIGFFFFIII	NM:i:1	MD:Z:0T50
SALLY:187:B02JLABXX:5:1101:1919:1960	81	U00096	2237700	30	51M	*	0	0	GCGTTCGGGCCAGACAGCCAGGCGTCCATCTTATCTTTCGCCTGAGCGGTC	###############B(;?BGGBFGBD??99?9CBAE@AFFDFD1D?=11#	NM:i:1	MD:Z:50G0
SALLY:187:B02JLABXX:5:1101:1900:1973	65	U00096	442575	30	51M	*	0	0	GCGGTGGAACTGTTTAACGGTTTCAACCAGCAGAGTGCTATCGCGAAAACA	#1=DBDFFHHGHHHIJJJJJGHIHJJHIII=FGAGBFGGIJJJJJEIJJGG	NM:i:1	MD:Z:0A50
\end{verbatim}

\subsection{BED File Format}

\begin{verbatim}
chrA	880	911	U	0	+
chrA	883	914	U	0	+
chrA	922	953	U	0	+
chrA	931	962	U	0	+
chrA	950	981	U	0	+
chrA	951	982	U	0	+
chrA	959	990	U	0	+
chrA	963	994	U	0	+
chrA	965	996	U	0	+
chrA	745	776	U	0	-
\end{verbatim}

\subsection{CSEM File Format}

\begin{verbatim}
chr11	114728597	114728633	HWUSI-EAS610:1:1:0:647#0/1	1000.00	+
chr5	138784256	138784292	HWUSI-EAS610:1:1:0:498#0/1	1000.00	-
chr3	8516078	8516114	HWUSI-EAS610:1:1:0:631#0/1	1000.00	-
chr7	123370863	123370899	HWUSI-EAS610:1:1:0:508#0/1	1000.00	+
chr4	137837148	137837184	HWUSI-EAS610:1:1:0:1790#0/1	1000.00	-
chr11	84363281	84363317	HWUSI-EAS610:1:1:0:862#0/1	1000.00	-
chr7	66950830	66950866	HWUSI-EAS610:1:1:0:1675#0/1	371.61	-
chr7	66938672	66938708	HWUSI-EAS610:1:1:0:1675#0/1	628.39	-
chr15	57549345	57549381	HWUSI-EAS610:1:1:0:969#0/1	1000.00	-
chr9	3012912	3012948	HWUSI-EAS610:1:1:0:194#0/1	448.96	+
\end{verbatim}

\clearpage

\section{Appendix: Example Lines of Aligned Read Files for PET ChIP-Seq Data}\label{example_aligned_PET}

\subsection{Eland Result File Format}

\begin{verbatim}
>SALLY:194:B045RABXX:3:1101:1225:2090	GAGCAACGGCCCGAAGGGCGAGACGAAGTCGAGTCA	U0	1	0	0	U00096	779900	R	..
>SALLY:194:B045RABXX:3:1101:1225:2090	GTTGCCACGGGATATCAAACAAACCGAAAGCAACGA	U0	1	0	0	U00096	779735	F	..
>SALLY:194:B045RABXX:3:1101:1197:2174	GGTTGTCTTCCGGGTTGAGGCGCGGAATGTCGAACG   U0	1	0	0	U00096	4080317	R	..
>SALLY:194:B045RABXX:3:1101:1197:2174	GTTTTCAGCTCAGCAACGCGCTCGCTCGCCAGCGTT   U0	1	0	0	U00096	4080169	F	..
>SALLY:194:B045RABXX:3:1101:1448:2081	TGAAATTCATCATGGCTGATACTGGCTTTGGTAAAA   U0	1	0	0	U00096	2474369	F	..
>SALLY:194:B045RABXX:3:1101:1448:2081	CCAATGGGTAAAATAGCGGGTAAAATATTTCTCACA   U0	1	0	0	U00096	2474522	R	..
>SALLY:194:B045RABXX:3:1101:1460:2102	ACATGTTCTTATTCTTACCTCGTAATATTTAACGCT   U0	1	0	0	U00096	2127671	R	..
>SALLY:194:B045RABXX:3:1101:1460:2102	TTTCCAGATACTCACGGGTGCCGTCGTTGGAACCGC   U0	1	0	0	U00096	2127518	F	..
>SALLY:194:B045RABXX:3:1101:1319:2153	AATGAAATGCTGTTTTCATAAAAAATAAAATTGAAG   U0	1	0	0	U00096	1785339	R	..
>SALLY:194:B045RABXX:3:1101:1319:2153	TTATCTTTGTATATTTAACCGGATGAAAAAAACGGT   U1	0	1	0	U00096	1785190	F	..
\end{verbatim}

\subsection{SAM File Format}

\begin{verbatim}
@HD	VN:1.0	SO:unsorted
@SQ	SN:U00096.2	LN:4639675
@PG	ID:Bowtie	VN:0.12.5	CL:"bowtie -q -X 1000 --fr -p 4 -S -n 2 -e 70 -l 28 --pairtries 100 --maxbts 125 -y -k 1 --phred33-quals /mnt/data/galaxy/tmp/tmpFJuBnU/tmpGke2nl -1 /mnt/data/galaxy/database/files/002/dataset_2246.dat -2 /mnt/data/galaxy/database/files/002/dataset_2247.dat"
AMELIA:216:C0LAWACXX:4:1101:1138:2071	99	U00096.2	182616	255	65M	=	182749	198	TTGCTGGTACTTTCACAGGGACGAGTCGTCGATATCGATGACGCGGTAGCACGTCATCTGCACGG	@@CFFFFDHFFFHBG@FAFEGGGGHHIIIBHIGCHHIHGIIIIIHIHHDDD@A>;?BDDDCCDDD	XA:i:0	MD:Z:65	NM:i:0
AMELIA:216:C0LAWACXX:4:1101:1138:2071	147	U00096.2	182749	255	65M	=	182616	-198	GTGAACCAGAGAATCTGCGTAAATATGGCGAACTGGTCTGCATGACGGCTGAAATGATGCTGGAA	HIIIGJIJJJIJIHGGGFGCIJGIIJJIHDIHGJJJJJIIJJIIHIFJIIJJHHHHHFDFFFC@C	XA:i:0	MD:Z:65	NM:i:0
AMELIA:216:C0LAWACXX:4:1101:1425:2097	99	U00096.2	4381249	255	65M	=	4381349	165	TGTTTACCTTTGGCGTAGAGCCAAATATTGGCAAAGAAAAACCGACCTTTGTGTACCACTTTCCA	CCBFFFFFHHHHHJJIJJJJJJJJJJJJJJJJJJJJJJJJIJIJJJJJJJIIIIJJGIHHHHGFF	XA:i:0	MD:Z:65	NM:i:0
AMELIA:216:C0LAWACXX:4:1101:1425:2097	147	U00096.2	4381349	255	65M	=	4381249	-165	AGATCATCGGGTCGCTGAACGCTTTGAGGTTTATTATAAAGGTATTGAGCTGGCGAATGGTTTCC	FFFFFFHHJJJJJIHIJJIJIJIEIJJJIJIJJJJJIJJJJJJJJJIIJJIJHHHHHFFFFFCCC	XA:i:0	MD:Z:65	NM:i:0
AMELIA:216:C0LAWACXX:4:1101:1213:2207	163	U00096.2	3632282	255	65M	=	3632429	212	CCATGTTGCAGGAAATAGATGATATGCAGGCCAAAATCGTTATCTATTTGCGAATCATTATCCAG	CCCFFFFFHHHHHJJJJJJJIIGJJJJIJJJJJGIJIGIGIJJJJJJJJJIJJJJJJJJIJGIJJ	XA:i:0	MD:Z:65	NM:i:0
AMELIA:216:C0LAWACXX:4:1101:1213:2207	83	U00096.2	3632429	255	65M	=	3632282	-212	TTATCTTGATGGCTTGAAGAGATGTTTCTAATCTGATTGTCAATTGCTTTCATAAATAACCTGTG	HJIGIJIJJIGEJIIIJJIJGJJIIIJJIJJJIIHIGJJJJJJJIIJIJJJIHHHHHEDFFFCCB	XA:i:0	MD:Z:65	NM:i:0
AMELIA:216:C0LAWACXX:4:1101:1167:2244	163	U00096.2	4135404	255	65M	=	4135541	202	CCAGTTTCTGCAAATCGACCTTCTGGCTGCGCAATGCGCGGATCACCACATCGGAACATACACCG	CCCFFFFFHHHHHJJJIJJJJJIJJJJJJJJJJJJIJJJJJJJHGHGFFFFFDDCDDDDDDDDDD	XA:i:0	MD:Z:65	NM:i:0
\end{verbatim}

\clearpage

\section{Appendix: Chromosome Information File}\label{example_chrfile}

The first and second columns indicate chromosome ID and its size, respectively.

\begin{verbatim}
chr1    249250621
chr2    243199373
chr3    198022430
chr4    191154276
chr5    180915260
chr6    171115067
chr7    159138663
chr8    146364022
chr9    141213431
chr10   135534747
\end{verbatim}

\end{document}
